The Expression of Involucrin, Loricrin, and Filaggrin in Cultured Sebocytes
نویسندگان
چکیده
134 Ann Dermatol Received November 29, 2012, Revised March 6, 2013, Accepted for publication March 25, 2013 Corresponding author: Weon Ju Lee, Department of Dermatology, Kyungpook National University School of Medicine, 200 Dongduk-ro, Jung-gu, Daegu 700-721, Korea. Tel: 82-53-420-5838, Fax: 82-53426-0770, E-mail: [email protected] This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. mentation and points to an optimistic future involving treatment without the need for invasive epidermal grafting.
منابع مشابه
Effects of Ambient Fine Particles PM2.5 on Human HaCaT Cells
The current study was conducted to observe the effects of fine particulate matter (PM2.5) on human keratinocyte cell line (HaCaT) cells. The potential mechanism linking PM2.5 and skin was explored. HaCaT cells were cultured and then accessed in plate with PM2.5. Cell viability was tested by Cell Counting Kit-8. The mRNA and protein expression of Filaggrin, Loricrin, Involucrin, and Repetin were...
متن کاملProtein composition of cornified cell envelopes of epidermal keratinocytes.
Terminally differentiated mammalian epidermal cells are lined with a 15 nm thick layer of proteins cross-linked by isodipeptide and disulfide bonds, called the cornified cell envelope (CE). A number of proteins, including involucrin, loricrin, cystatin A, filaggrin, a cysteine-rich protein (CRP) and the 'small proline-rich' proteins (SPRRs) have been reported to be components of this complex, b...
متن کاملFilaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR...
متن کاملCathepsin D is involved in the regulation of transglutaminase 1 and epidermal differentiation.
We previously demonstrated that the aspartate protease cathepsin D is activated by ceramide derived from acid sphingomyelinase. Increased expression of cathepsin D in the skin has been reported in wound healing, psoriasis and skin tumors. We explored specific functions of cathepsin D during epidermal differentiation. Protein expression and enzymatic activity of cathepsin D increased in differen...
متن کاملMyocardial Infarction in a Patient Treated with Anti-Interleukin-12 Biological Agent for Chronic Plaque Psoriasis
Vol. 26 No. 1, 2014 137 Received January 3, 2013, Revised March 5, 2013, Accepted for publication March 27, 2013 Corresponding author: Giuseppe Stinco, Institute of Dermatology, University of Udine, Ospedale “San Michele” di Gemona piazza Rodolone 1, Gemona del Friuli (Udine) 33013, Italy. Tel: 39-0432-989378, Fax: 39-0432-989209, E-mail: [email protected] This is an Open Access article ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
دوره 26 شماره
صفحات -
تاریخ انتشار 2014